View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15773_high_33 (Length: 275)
Name: NF15773_high_33
Description: NF15773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15773_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 209
Target Start/End: Complemental strand, 2537284 - 2537077
Alignment:
| Q |
2 |
agttgtgagaacaaaaaatacttcagtttctactcatgacgagaaacatcggttattgctaattttaaaccacttcaaacattagttcactgtaaatcac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2537284 |
agttgtgagaacaaaaaatacttcagtttctactcatgacgagaaacatcggttattgctaattttaaaccacttcaaacattagttcactataaatcac |
2537185 |
T |
|
| Q |
102 |
atgagacacttctcatctaaaaggtcatcaatcatcatgaagtaatagtggcaaacaccattactctcatcaacgttctgtcgatgggagcttgcagata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2537184 |
atgagacacttctcatctaaaaggtcatcaatcatcatgaagtaatagtggcaaacaccattactctcatcaacgttctgtcgatgggagcttgcagata |
2537085 |
T |
|
| Q |
202 |
tcatgcct |
209 |
Q |
| |
|
|||||||| |
|
|
| T |
2537084 |
tcatgcct |
2537077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 208 - 275
Target Start/End: Complemental strand, 2536838 - 2536771
Alignment:
| Q |
208 |
cttagataaacttggcctggtgtttcaaaatagtgtattagtagtaaagggatccgtgaaggaaaaaa |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2536838 |
cttagataaacttggcctggtgtttcaaaatagtgtattagtagtaaagggatccgtgaaggaaaaaa |
2536771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 212 - 271
Target Start/End: Complemental strand, 2532766 - 2532707
Alignment:
| Q |
212 |
gataaacttggcctggtgtttcaaaatagtgtattagtagtaaagggatccgtgaaggaa |
271 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
2532766 |
gataaacctggcctagtgtttcaaaatagtgtgttggtagtaaagggattcgtgaaggaa |
2532707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University