View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15773_high_43 (Length: 252)
Name: NF15773_high_43
Description: NF15773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15773_high_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 6118898 - 6118681
Alignment:
| Q |
9 |
caagaatatatacctaaataaatgagcagatattacaagaacagatggatgctaaacaaccaaaaactgatgatgatcactacctgtcaatcacactgat |
108 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6118898 |
caagaatatatacctaaat----gagcagata---caagaacagatggatgctaaacaaccaaaaactgatgatgatcactacctgtcaatcacactgat |
6118806 |
T |
|
| Q |
109 |
ggtttctcttgcactatactctctcttctctataggaaatatgaaaggtaaaatgacactagtgagagcttcaatttatatagagaaaatttgagggact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
6118805 |
ggtttctcttgcactatactctctcttctctataggaaatatgaaaggtaaaatgacactagtgagagcttcaatt--tatagagaaaattttagggact |
6118708 |
T |
|
| Q |
209 |
ctaacagacttatatattatttttaat |
235 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
6118707 |
ctaacaggcttatatattatttttaat |
6118681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 129 - 235
Target Start/End: Complemental strand, 6137261 - 6137155
Alignment:
| Q |
129 |
ctctcttctctataggaaatatgaaaggtaa-aatgacactagtgagagcttcaatttatatagagaaaatttgagggactctaac-agacttatatatt |
226 |
Q |
| |
|
|||| ||||||||| | ||||||||||| || ||||||||||| || ||||| || ||||| ||||||| ||||||| ||||| | ||||| ||| ||| |
|
|
| T |
6137261 |
ctcttttctctataagcaatatgaaaggcaagaatgacactagagaaagcttgaa--tatattgagaaaaattgagggtctctatctagactgatacatt |
6137164 |
T |
|
| Q |
227 |
atttttaat |
235 |
Q |
| |
|
||||||||| |
|
|
| T |
6137163 |
atttttaat |
6137155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 6149899 - 6149854
Alignment:
| Q |
158 |
aaaatgacactagtgagagcttcaatttatatagagaaaatttgaggg |
205 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
6149899 |
aaaatgacactatagagagcttcaatt--tatagagaaaatttgaggg |
6149854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University