View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15773_low_10 (Length: 430)
Name: NF15773_low_10
Description: NF15773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15773_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 10 - 312
Target Start/End: Original strand, 26840383 - 26840688
Alignment:
| Q |
10 |
caatgattaaaccttatctcgctagtagtacaaatgtatatgtgtgattctgagaatgtgttttgcttctttaacaattttgcattggtgaggctttagt |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26840383 |
caatgattaaaccttatctggctagtagtacaaatgtatatgtgtgattctgagaatgtgttttgcttctttaacaattttgcattggtgaggctttagt |
26840482 |
T |
 |
| Q |
110 |
agcacgcacaaaatgacactacactacaaccacgttgaaaattgctcaacatctcaaagccaagactat---aacagccagcatgtccttttttgtatat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26840483 |
agcacgcacaaaatgacactacactacaaccacgttgaaaattgctcaacatctcaaagccaagactataacaacagccagcatgtccttttttgtatat |
26840582 |
T |
 |
| Q |
207 |
gatgattcaaccgttcaaagtctttgaattaacaactttagtttagttcgtaggtttgaacaactgaacacccttatagtaatagaaaactcacctaaaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||| |
|
|
| T |
26840583 |
gatgattcaaccgttcaaagtctttgaattaacaactttagtttagttcgtaggtttgaacaactgaacacccttatagtaatagaaagctcacttgaaa |
26840682 |
T |
 |
| Q |
307 |
ccggtt |
312 |
Q |
| |
|
|||||| |
|
|
| T |
26840683 |
ccggtt |
26840688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 310 - 422
Target Start/End: Original strand, 26840736 - 26840848
Alignment:
| Q |
310 |
gttcttctacaagtcaatattgtcatttagactcaaaccattctcaaaaatatctgatcatattcattttattctttgtaattccttttactctcgggtg |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
26840736 |
gttcttctacaagtcaatattgtcatttagactcaaaccattctcaaaaatatccgatcatattcattttattcattgtaattccttttactctcgggcg |
26840835 |
T |
 |
| Q |
410 |
cggtgatgatgtc |
422 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
26840836 |
cggttatgatgtc |
26840848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University