View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15773_low_18 (Length: 357)
Name: NF15773_low_18
Description: NF15773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15773_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 125 - 248
Target Start/End: Original strand, 8385649 - 8385772
Alignment:
| Q |
125 |
caacaatggctactatggaagctacaatgagaagggttgtaaagagggagatgaggagttttttcttgttgccggaattcgagattccggcgagggattg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8385649 |
caacaatggctactatggaagctacaatgagaagggttgtaaagagggagatgaggagttttttcttgttgccggaattcgagattccggcgagggattg |
8385748 |
T |
 |
| Q |
225 |
ttttattttgttcatgattggttt |
248 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8385749 |
ttttattttgttcatgattggttt |
8385772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 8385525 - 8385609
Alignment:
| Q |
1 |
agttcagggtagagagtggtggtgcaagcggatttgagtatggcgtgagaatggtgagagagtgaaagagaagatgaagcaatgc |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8385525 |
agttcagggtagagagtggtggtgcaagcggatttgagtatggcgtgagaatggtgagagagtgaaagagaagatgaagcaatgc |
8385609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University