View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15773_low_23 (Length: 345)
Name: NF15773_low_23
Description: NF15773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15773_low_23 |
 |  |
|
| [»] scaffold1246 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold1246 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: scaffold1246
Description:
Target: scaffold1246; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 6 - 345
Target Start/End: Complemental strand, 960 - 621
Alignment:
| Q |
6 |
tatcaaaggcttcaataaggttttcaaaattccttatggtgtgaatttggataagatcaaaggaaattacaatgaagaggaatggattttgaatatttac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
960 |
tatcaaaggcttcaataaggttttcaaaattccttatggtgtgaatttggataagatcaaaggaaattacaatgaagaggaatggattttgaatatttac |
861 |
T |
 |
| Q |
106 |
atgccaaagttggtaaaagggatttttggtcttaaggttgaggaagtcaaggaacaagagaatgataaaagaaaatcagagctagagaaaggtgaaattg |
205 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
860 |
atgccaaattttgtaaaagggatttttggtcttaagtttgaggaagtcaaggaacaagagtttgataaaagaatatcagagctagataaatgtgaaattg |
761 |
T |
 |
| Q |
206 |
atcatgtttctagtagtgttggtgagacaagccaaaaagagtcaaaagattctgaatttcaacacatgaaaggaagtgacaatggcatagagaagatgct |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
760 |
atcatgtttctagtagtgttggtgagacaagccaaaaagagtcaaaagattctgaatttcaacacatgaaaggaagtgacaatggcatagagaagatgct |
661 |
T |
 |
| Q |
306 |
tgatgataacgtcgatgaaaataataaagagacgatacaa |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
660 |
tgatgataacgtcgatgaaaataataaagagactatacaa |
621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University