View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15773_low_30 (Length: 299)
Name: NF15773_low_30
Description: NF15773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15773_low_30 |
 | |
|
| [»] scaffold0140 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 13 - 204
Target Start/End: Original strand, 33097 - 33287
Alignment:
| Q |
13 |
aaaaagaaaattaagcttctgaatttatgttccttgaacaatatcaatgtatccaatatttgttttttccatacttttttcttcctattctttgtaaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33097 |
aaaaagaaaattaagcttctgaatttatgttccttgaataatatcaatgtatccaatatttgttttttccatactttt-tcttcctattctttgtaaatc |
33195 |
T |
|
| Q |
113 |
ttgtcaatttctacgttgtaaagaatatatggtgcagaaagatcataggccagctatagaacagagaggatacaaagcgaccttaactagtg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33196 |
ttgtcaatttctacgttgtaaagaatatatggtgcagaaagatcataggccagctatagaacagagaggatacaaagcgaccttaactagtg |
33287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 241 - 290
Target Start/End: Original strand, 33326 - 33375
Alignment:
| Q |
241 |
gctctaaaatcatatatcatgttttggctaaaccaattagaatcctttgt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33326 |
gctctaaaatcatatatcatgttttggctaaaccaattagactcctttgt |
33375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University