View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15773_low_34 (Length: 281)
Name: NF15773_low_34
Description: NF15773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15773_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 26839894 - 26839633
Alignment:
| Q |
1 |
taaaaagtaaaagcacacaaatta----gtggaactaatacatcttgcatatttaaaaatctccatcaagttcaaccagggatttttcatattctaaagg |
96 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26839894 |
taaaaagtaaaagcacacaaattaattagtggaactaatacatcttgcatatttaaaaatctccatcaagttcaaccagggatttttcatattctaaagg |
26839795 |
T |
|
| Q |
97 |
ttgtctctaagttgctcaaaatgtatattataagcaaacaaaagcattgactatatgaatttagagcattgataggacacttagcttgttgtagacataa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26839794 |
ttgtctctaagttgctcaaaatgtatattataagcaaacaaaagcattgactatatgaatttagagcattgataggaca-----cttgttgtagacataa |
26839700 |
T |
|
| Q |
197 |
ttggctgttacatataatttgcatcttagtaatagtcaagtcttcctttccttctcacatgcaatct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26839699 |
ttggctgttacatataatttgcatcttagtaatagtcaagtcttcctttccttctcacatggaatct |
26839633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University