View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15773_low_50 (Length: 244)
Name: NF15773_low_50
Description: NF15773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15773_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 92 - 207
Target Start/End: Original strand, 18936125 - 18936243
Alignment:
| Q |
92 |
actaactagcaaacattccaatttaaattttggaatgttaccaaaaggtgatcgtgttccaccatcgggacctagcaataaaacatctga---ctctcca |
188 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
18936125 |
actaactaacaaacattccaatttaaattttgaaatgttaccaaaaggtgatcgtgttccaccatcgggacctagcaataaaacatctgatggccctcca |
18936224 |
T |
|
| Q |
189 |
cctccaccacatattcttc |
207 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
18936225 |
cctccaccacattttcttc |
18936243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 18935991 - 18936068
Alignment:
| Q |
18 |
gatcttggtttagggtacattccacacccaccacctttgccttctcacatagtcaaaatgttgattccctctccacta |
95 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18935991 |
gatcttggcttagggtacattccacacccaccacctttgccttctcacatagtcaaaatgttgattccctctccacta |
18936068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 161
Target Start/End: Complemental strand, 21947535 - 21947499
Alignment:
| Q |
125 |
aatgttaccaaaaggtgatcgtgttccaccatcggga |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21947535 |
aatgttaccaaaaggtgagcgtgttccaccatcggga |
21947499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University