View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15774_low_9 (Length: 242)
Name: NF15774_low_9
Description: NF15774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15774_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 232
Target Start/End: Complemental strand, 6316544 - 6316321
Alignment:
| Q |
9 |
agcagagatctgaatgtagataactaataaaaccatcggtaataaacaaccttatgttgcaagatatgtacaaaacggtggctcattttttaactaatat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316544 |
agcagagatctgaatgtagataactaataaaaccatcggtaataaacaaccttatgttgcaagatatgtacaaaacggtggctcattttttaactaatat |
6316445 |
T |
 |
| Q |
109 |
ggttggataaatcattttaattgtgatttatgtgttgatttcatgcctctgccttgagtgtaatgtccattttgtgtatttagtatgatggaggaactag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316444 |
ggttggataaatcattttaattgtgatttatgtgttgatttcatgcctctgccttgagtgtaatgtccattttgtgtatttagtatgatggaggaactag |
6316345 |
T |
 |
| Q |
209 |
ctttacacaaagtattgtgatgat |
232 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6316344 |
ctttacacaaagtattgtgatgat |
6316321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University