View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15775_high_8 (Length: 345)
Name: NF15775_high_8
Description: NF15775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15775_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 15 - 313
Target Start/End: Complemental strand, 37767928 - 37767632
Alignment:
| Q |
15 |
agaaaggacctttatatgcgtctgctttcaaccctctaatgcttttgattgtagctttcgtcgcatccatgcttttggatgagaagttaaacctcggaag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37767928 |
agaaaggacctttatatgcgtctgctttcaaccctctaatgcttttgattgtagctttcgtcgcatccatgctcttggatgagaagttaaacctcggaag |
37767829 |
T |
 |
| Q |
115 |
gtatacattatatactaaatctaagttcttttaaatgagtatgcatggatcctttgcagagagattgaaccaatttgaatgttgttattggatctgatga |
214 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37767828 |
gtatatattatatactaaatctaagttcatttaaatgagtatgcatggatcctttgca--gagattgaaccaatttgaatgttgttattggatctgatga |
37767731 |
T |
 |
| Q |
215 |
tatatagttggtctggtctggtcgtgatgaatatgcaaatttatgatgtttttccttctgttttgctagcctttgtattcataatttgatttaatatag |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37767730 |
tatatagttggtctggtctggtcgtgatgaatatgcaaatttatgatgtttttctttttgttttgctagcctttgtattcataatttgatttaatatag |
37767632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University