View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15775_high_9 (Length: 325)
Name: NF15775_high_9
Description: NF15775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15775_high_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 25 - 325
Target Start/End: Complemental strand, 37555685 - 37555396
Alignment:
| Q |
25 |
agtgcatgtttggatcaacaacttaatgcatgtttagattgacgatgaatttgtggcaaaaactacaaattggagaataaaatcaagtatgtcgctgtta |
124 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37555685 |
agtgcatgtttggatcaac---ttaatgcatgtttagattgtcgatgaatttgtggcaaaaactacaaattggagaataaaatcaagtatgtcactgtta |
37555589 |
T |
 |
| Q |
125 |
tttttacaaatttaccgtgaatccaaatatccaattatccaaacatgcaggaagtgccaatttnnnnnnnnnnntgcttgactttttctgcatccaattt |
224 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
37555588 |
ttttgacaaatttaacgtgaatccaaatat--------ccaaacatgcaggaagtgccaatttaaaaaaaaaaatgcttgactttttctgcatgcaattt |
37555497 |
T |
 |
| Q |
225 |
ttgtgaaaccaaacatagcacaatgcaaacaagtaacaacactcatgcaaatgcaaacgnnnnnnnntaaaagcaaaacagaaagtaagaagctgattga |
324 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37555496 |
ttgtgaaaccaaacatagcataatgcaaacaagtaacaacactcatgcaaatgcaaacgaaaaaaaataaaagcaaaacagaaagtaagaagctgattga |
37555397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University