View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15775_low_12 (Length: 281)
Name: NF15775_low_12
Description: NF15775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15775_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 75 - 275
Target Start/End: Original strand, 52154763 - 52154963
Alignment:
| Q |
75 |
tgtccaactcggccacaagaagaaattcagataaagatgatatggaagattcgtcattgccatcgattgtgggcaaaagattacagaattcatttgaaga |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52154763 |
tgtccaactcggccacaagaagaaattcagataaagatgatatggaagattcatcattgccatcgattgtgggcaaaagattacagaattcatttgaaga |
52154862 |
T |
|
| Q |
175 |
gatggaagcggttggatttaagagaagattcttggattgttcttgatgcatgtatttctcatcaagatcttcaacactttgataaatgtttcctatgcta |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52154863 |
gatggaagcggttggatttaagagaagattcttggattgttcttgatgcatgaatttctcatcaagatcttcaacactttgataaatgtttcctatgcta |
52154962 |
T |
|
| Q |
275 |
c |
275 |
Q |
| |
|
| |
|
|
| T |
52154963 |
c |
52154963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University