View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15775_low_16 (Length: 238)
Name: NF15775_low_16
Description: NF15775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15775_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 55145528 - 55145730
Alignment:
| Q |
19 |
cagagacacaaaagtaggtgtagcttttggaatggttgcagcaaggagatatggaacagacatgacattgtggtatggactgaaagggagaggagatcct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55145528 |
cagagacacaaaagtaggtgtagcttttggaatggttgcagcaaggagatatggaacagacatgacattgtggtatggactgaaagggagaggagatcct |
55145627 |
T |
|
| Q |
119 |
tataggactcttttgagagaagggatcactgcacttcttaactcatataacagcatccaattctcttaccatccacttggtgtaatcacacacatgaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55145628 |
tataggactcttttgagagaagggatcactgcacttcttaactcatataacagcatccaattctcttaccatccacttggtgtaatcacacacatgaatt |
55145727 |
T |
|
| Q |
219 |
atg |
221 |
Q |
| |
|
||| |
|
|
| T |
55145728 |
atg |
55145730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University