View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_high_20 (Length: 407)
Name: NF15777_high_20
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 49495516 - 49495397
Alignment:
| Q |
8 |
tagcatagggcaactagaattttgaatgtaatcacaattcaaaacatagcattatctgtgtagttttcttttgtatggatgttgtgaaacatgacatcta |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49495516 |
tagcattgggcaactagaattttgaatgtaatcacaattctaaacatagcattatctgtgtagttttcttttgtatggatgttgtgaaacatgacatcta |
49495417 |
T |
 |
| Q |
108 |
ttgaagggggagagagaaaa |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49495416 |
ttgaagggggagagagaaaa |
49495397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University