View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_high_26 (Length: 342)
Name: NF15777_high_26
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 149 - 255
Target Start/End: Complemental strand, 41567207 - 41567101
Alignment:
| Q |
149 |
gtcatgaatctctataaaaaggaggttatttcttggtctaccgtaagaagctttagggaagaattgaaaaacctctcttggcaaacatgagattcaacaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41567207 |
gtcatgaatctctataaaaaggaggttatttcttggtctaccgtaagaagctttagggaagaattgaaaaacctctcttggcaaacttgagattcaacaa |
41567108 |
T |
|
| Q |
249 |
aatctta |
255 |
Q |
| |
|
||||||| |
|
|
| T |
41567107 |
aatctta |
41567101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 149 - 250
Target Start/End: Original strand, 41434313 - 41434411
Alignment:
| Q |
149 |
gtcatgaatctctataaaaaggaggttatttcttggtctaccgtaagaagctttagggaagaattgaaaaacctctcttggcaaacatgagattcaacaa |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41434313 |
gtcatgaatctttataaaaaggaggttatttcttggtctaccgtaag---ctttaggtaagaattgaaaaacctctcttggtaaacatgagattcaacaa |
41434409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 328
Target Start/End: Complemental strand, 41567075 - 41567028
Alignment:
| Q |
281 |
caattatcattctccattaccccgcgccgtttttccccattgcaaaca |
328 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
41567075 |
caattatcattctccattaccccacgccgtttttccccattgctaaca |
41567028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University