View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_high_32 (Length: 298)
Name: NF15777_high_32
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 12367103 - 12366962
Alignment:
| Q |
1 |
ataggttagattaacccttggaatttcagaccccaactctttaattaaaatgtttgcctaaagcacttttaatgcctgactgaagagggtgggaattttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12367103 |
ataggttagattaacccttggaatttcaggccccaactctttgattaaaatgtttgcctaaagcacttttaatgcctgactgaagagggtggggattttc |
12367004 |
T |
|
| Q |
101 |
ttcccgcaaggaattaaatttgaacaatataggaaactagga |
142 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12367003 |
ttcccacaaggaattaaatttgaacaatataggaaactagga |
12366962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 202 - 282
Target Start/End: Complemental strand, 12366963 - 12366883
Alignment:
| Q |
202 |
gaagatatcaatggaattcatgtatttatgtgatgctaaatgggtcttgatcaagtcaaaatagaggccaaagttatggtt |
282 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12366963 |
gaagatatcaatggaaatcatgtatttatgtgatgctaaatgggtcttgatcaagtcaaaatagaggccaaagttatggtt |
12366883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University