View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_high_40 (Length: 251)
Name: NF15777_high_40
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 243
Target Start/End: Original strand, 12367126 - 12367358
Alignment:
| Q |
4 |
gaggtaagcctaaattgcttatatattgattgatatttggaaggtggtgtgaatcataatggatatgaccaagctagggatcatgaatgaaaaacaaaat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12367126 |
gaggtaagcctaaattgcttatatattgattgtta-------ggtggtatgaatcataatggatatgaccaagctagggatcatgaatgaaaaacaaaat |
12367218 |
T |
 |
| Q |
104 |
tataatcttttttaaattaccgaataataaagttaaatatttagattttaatcatgagattgaagccctcattctcattatatattttctgcaacttaat |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
12367219 |
tataatcttttttacattaccgaataataaagttaaatatctagattttaatcatgagattgaagccctcattctcattttatatttgctgcaacttaat |
12367318 |
T |
 |
| Q |
204 |
atatacatgaaatttcatgctatctctaatcttcatttca |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12367319 |
atatacatgaaatttcatgctatctctaatcttcttttca |
12367358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University