View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_high_47 (Length: 237)
Name: NF15777_high_47
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 67 - 222
Target Start/End: Complemental strand, 14132973 - 14132818
Alignment:
| Q |
67 |
gattgtttagtaaattggatttttatgggatgtttaagattttattagcaaatttttaacatgaaaagatctttaatgaaaacatcaaataaaagagtgt |
166 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14132973 |
gattgtttagtaaattggatttatatgggatgtttaagattttattagcaaatttttaacatgaaaagatctttaatgaaaacatcaaataaaagagtgt |
14132874 |
T |
 |
| Q |
167 |
gttttgaaatttgtttttaagggcgtgtattgagaatataatgaaataaagtgtgt |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
14132873 |
gttttgaaatttgttttcaagggcgtgtatcgagaatataatgaaataaaatgtgt |
14132818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University