View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_low_28 (Length: 377)
Name: NF15777_low_28
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 207
Target Start/End: Complemental strand, 41711403 - 41711208
Alignment:
| Q |
12 |
atgaataggtaaaaggtgaatcgagaaagatccggaaattgggatttttgcctcgccgttggatttcatttttcaaaaattaatcaacgcttcagatttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41711403 |
atgaataggtaaaaggtgaatcgagaaagatccggaaattgggattttcgcctcgccgttggatttcatttttcaaaaattaatcaacgcttcagatttt |
41711304 |
T |
 |
| Q |
112 |
attattatagtttaattctttacaacaagttgtggaaattgccaacatatcctttacttgaccaagccaagccaaatgaacaccgaaatagagacg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41711303 |
attattatagtttaattctttacaacaagttgtggaaattgccaacatatcctttacttgaccaagccaagccaaatgaacaccgaaatagagacg |
41711208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 282 - 318
Target Start/End: Complemental strand, 41711134 - 41711098
Alignment:
| Q |
282 |
gtggaatgttaagttaggcttcctttgagagtttaaa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41711134 |
gtggaatgttaagttaggcttcctttgagagtttaaa |
41711098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 346 - 377
Target Start/End: Complemental strand, 41711077 - 41711046
Alignment:
| Q |
346 |
gatattgagagatgaaagttttggaggttaaa |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41711077 |
gatattgagagatgaaagttttggaggttaaa |
41711046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University