View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_low_38 (Length: 301)
Name: NF15777_low_38
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 10 - 279
Target Start/End: Complemental strand, 46630050 - 46629780
Alignment:
| Q |
10 |
catcatcataacctttacagtatgctgagcagaatgtgacactgataacaacaattccatgttagcttgcaaaacaaactggagaccgtacgtgaagtta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46630050 |
catcatcataacctttacagtatgctgagcagaatgtgacactgataacaacaattccatgttagcttgcaaaacaaactggagaccgtacgtgaagtta |
46629951 |
T |
|
| Q |
110 |
tagtgatgtcaattgccagatgttttaaatagtttcagattatgatagtagttatgaatgagattggtcacccataccaagctttaaattaagattactt |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46629950 |
tagagatgtcaattgccagatgttttaaatagtttcagattatgatagtagttatgaatgagattggtcacccataccaagctttaaattaagattgctt |
46629851 |
T |
|
| Q |
210 |
ggcttcaatggtggctaaatgattta-ttacttggaccccttacttaacataacacatgttatagatattt |
279 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46629850 |
ggcttcaatggtggctaaatgatttatttacttggaccccttacttaacataacacatgttatagatattt |
46629780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University