View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_low_44 (Length: 267)
Name: NF15777_low_44
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 10427159 - 10427361
Alignment:
| Q |
1 |
gcattagcaattatacaaaatgaagtagcttagttgatttatttcgtgttgttaatgttaatggatatgcatcaagaagctgactatttattgtgaattt |
100 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10427159 |
gcattagca-ttacacaaaatgaagtagcttagtttatttatttcgtgttgttaatgttaatggatatgcatcaagaagctgactatttattatgaattt |
10427257 |
T |
 |
| Q |
101 |
taacaaataaagttatcttcaattactatttgag-aacaaaatcaaaattttataaaannnnnnnnnnnntttgcaaataagattctcaaattaagtttt |
199 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10427258 |
taacaaatagaattatcttcaattactatttgagaaacaaaatcaaaattttctaaaagagtgtgtgtgttttgcaaataagattctcaaattaagtttt |
10427357 |
T |
 |
| Q |
200 |
caaa |
203 |
Q |
| |
|
|||| |
|
|
| T |
10427358 |
caaa |
10427361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 5 - 61
Target Start/End: Original strand, 10430547 - 10430601
Alignment:
| Q |
5 |
tagcaattatacaaaatgaagtagcttagttgatttatttcgtgttgttaatgttaa |
61 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| ||| |||||| ||||||||| |
|
|
| T |
10430547 |
tagcaattacacaaaatgaagtagcttagtttatt--ttttgtgttgctaatgttaa |
10430601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University