View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_low_47 (Length: 260)
Name: NF15777_low_47
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 2 - 247
Target Start/End: Complemental strand, 25011720 - 25011473
Alignment:
| Q |
2 |
tgagatgga-catcatcaagatgcacacaggcagaggatcgttgactggatcagtgctgctggtggtactgcaggtgcatttgatgttacaaccaaaggg |
100 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011720 |
tgagatggatcataatcaagatgcacacaggcagaggatcgttgactggatcagtgctgctggtggtactgcaggtgcatttgatgttacaaccaaaggg |
25011621 |
T |
 |
| Q |
101 |
attcttcactctgtgagtactcaacttgacggtttcaataatttctcttcaaacttactcttcaatcctgtggaattcttcgaatagtgtatagcactta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011620 |
attcttcactctgtgagtactcaacttgacggtttcaataatttctcttcaaacttactcttcaatcctgtggaattcttcgaatagtgtatagcacttt |
25011521 |
T |
 |
| Q |
201 |
cacgaaacgataatttgacaaagcaacgtg-tttcagatatactagtt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25011520 |
ttcgaaacgataatttgacaaagcaacgtgttttcagatatactagtt |
25011473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University