View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15777_low_53 (Length: 250)
Name: NF15777_low_53
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15777_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 14133060 - 14133300
Alignment:
| Q |
1 |
cttgattgaatatcataagatttattctcaagaatttttcttcgtaaaaaagttttaaaatcctaattaaatacacttcccataattccataatannnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
14133060 |
cttgattgaatatcataagatttattctcaagaatttttcttcgtaaaaaagttttaaaatcttaattaaatacacttcctataattccataatattttt |
14133159 |
T |
|
| Q |
101 |
nnncaatatattgagtatattttatttacatgttgttctgcaaaa--aattgttgcttctacctttagcggaaatcacttatgagatgagatggtatgaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14133160 |
ttt-aatatattgagtatattttatttacatgttgttctgcaaaaaaaattgttgcttctacctttagcggaaatcacttatgagatgagatggtatgaa |
14133258 |
T |
|
| Q |
199 |
ataaagggctgaaattgattggcgtgtttcgtccctcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14133259 |
ataaagggctgaaattgattggcgtgtttcgtccctcctttg |
14133300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University