View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15778_low_7 (Length: 311)
Name: NF15778_low_7
Description: NF15778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15778_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 158 - 293
Target Start/End: Original strand, 8140443 - 8140580
Alignment:
| Q |
158 |
ttgatgtggtccatgcacaaggatga--cacacaaattgagagaaataaattttatgtggtcctaattgcatgttataggtagttgtgataatatcagaa |
255 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8140443 |
ttgatgtggtccatgcacaaggatgagacacacaaattgagagaaataaattttatgtggtcctaattgcatgttataggtagttgtgataatatcagaa |
8140542 |
T |
 |
| Q |
256 |
ctaatattacatttgttaacatttttgttatatactac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8140543 |
ctaatattacatttgttaacatttttgttatatactac |
8140580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 8140370 - 8140454
Alignment:
| Q |
27 |
agatgatatttgaaatagtaatctcagccacattgcaataattgatattgtagacaattattctcaattatagttgatgtggtcc |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
8140370 |
agatgatatttgaaatagtaatcttagccacattgcaataattgatattgtagacaatcattctcaattataattgatgtggtcc |
8140454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University