View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1578-Insertion-6 (Length: 255)
Name: NF1578-Insertion-6
Description: NF1578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1578-Insertion-6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 54 - 255
Target Start/End: Original strand, 3525183 - 3525381
Alignment:
| Q |
54 |
ctcaaaacatttgttatatttttcggatgtgccctttaaaaaattaaatgggatgtgaaaacgcattgactattttcttgctccaccaaatcaactttct |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3525183 |
ctcaaaacatttgttatatttttcggatgtgccctttaaaaaa---aatgggatgtgaaaacacattgactattttcttgctccaccaaatcaactttct |
3525279 |
T |
 |
| Q |
154 |
cgatccgtcagtgccttcttcttcctaatgaaacaatacaaatgcccaaataaaaaggatgatgcagattctagttaaagtagctttgccagcagctcct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3525280 |
cgatccgtcagtgccttcttcttcctaatgaaacaatacaaatgcccaaataaaaaggatgatgcagattctagttaaagtagctttgccagcaactcct |
3525379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University