View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15780_high_8 (Length: 264)
Name: NF15780_high_8
Description: NF15780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15780_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 259
Target Start/End: Original strand, 28935318 - 28935562
Alignment:
| Q |
15 |
gaccacatacacacgaaaacaactgcaacatgtgaaactcacacacacatttggtgtctacagatgaaagcatacaaatatgcatggtcatgtcgttnnn |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28935318 |
gaccacatacacacgaaaacaactgcaacatgtgaaactcacacatacatgtgatgtctacagatgaaagcatacaaatatgcatggtaatgtcgttaga |
28935417 |
T |
|
| Q |
115 |
nnnnnnnnnggttatgaagaatggaacctctaatggggaagcatcatcgaattcggaacctgaggaaaatgagtcatgatcatagcttttgaattcatca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
28935418 |
gagagagagggttatgaagaatggaacctctaatggggaagcatcatcaaattcggaacctgaggaaaacgagtcatgatcatcgcttttgaattcatca |
28935517 |
T |
|
| Q |
215 |
tcttcatagctgttttgttgttcaacctcaatggcctttgcttct |
259 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
28935518 |
tcttcataactgttttgttgttccacctcaatggccattgattct |
28935562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University