View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15780_high_9 (Length: 260)
Name: NF15780_high_9
Description: NF15780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15780_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 88 - 241
Target Start/End: Complemental strand, 44083268 - 44083115
Alignment:
| Q |
88 |
taactcattcatttatctatacattgtcaatatgtagtttactattgggttacgaagtgaaccctgagaatcatccacgttcaaataaaagcatacatac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44083268 |
taactcattcatttatctatacattgtcaatatgtagtttattattgggttacgaagtgagctctgagaatcatccacgttcaaataaaagtatacatac |
44083169 |
T |
|
| Q |
188 |
aagtaggaaatatatcatactcttacctaaaatctaaagacgatatgtttatga |
241 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
44083168 |
aagtaggaaagatatcatactcttacctaaaatctaaagatgatgtgtttatga |
44083115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 53 - 89
Target Start/End: Complemental strand, 44083357 - 44083320
Alignment:
| Q |
53 |
gataattacacgatcaaaatag-ttttgatttaaaata |
89 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44083357 |
gataattacacgatcaaaatagtttttgatttaaaata |
44083320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University