View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15781_high_2 (Length: 403)
Name: NF15781_high_2
Description: NF15781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15781_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 16 - 384
Target Start/End: Original strand, 39278406 - 39278774
Alignment:
| Q |
16 |
gagatgaagctgcagacaattgagcaacaacgaaatattttgacaatgctagagaaatctttggcaaaagaaagggatcttgagaataatttatatcatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39278406 |
gagatgaagctgcagacaattgagcaacaacgaaatattttgacaatgctagagaaatctttggcaaaagaaagggatcttgagaagaatttatatcatt |
39278505 |
T |
 |
| Q |
116 |
ctagagaaattcaggaaaagctgaaacaaagtatgtcctccttagagcacgagctagttcaagcggaggaagaaactattgatgtttgggaaagattgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39278506 |
ctagagaaattcaggaaaagctgaaacaaagtatgtcctccttagagcacgagctagttcaagcggaggaagaaactattgatgtttgggaaagattgtt |
39278605 |
T |
 |
| Q |
216 |
tgaggctgacaatgcacatgagattctgatgggaatttcaaaaagtctgttgagtagactccagatttctcatttcaatttgaatggtttaagtcggcgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39278606 |
tgaggctgacaatgcacatgagattctgatgggaatttcaaaaagtctgttgagtagactccagatttctcatttcaatttgaatggtttaagtcggcgt |
39278705 |
T |
 |
| Q |
316 |
gaatccgagcttcaagctaagctcgaaacttttgtagaacaattaaataccagggatattattttgaac |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39278706 |
gaatccgagcttcaagctaagctcgaaacttttgtagaacaattaaataccagggatattattttgaac |
39278774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 257
Target Start/End: Original strand, 5662221 - 5662314
Alignment:
| Q |
164 |
acgagctagttcaagcggaggaagaaactattgatgtttgggaaagattgtttgaggctgacaatgcacatgagattctgatgggaatttcaaa |
257 |
Q |
| |
|
||||| || ||||| | ||||||||| | || || |||||||||||||| |||||||| |||||||| | |||||| |||| |||||||||||| |
|
|
| T |
5662221 |
acgagttaattcaaacagaggaagaagcgatcgaagtttgggaaagattttttgaggcagacaatgcgcgtgagatcctgaagggaatttcaaa |
5662314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 107
Target Start/End: Original strand, 5662083 - 5662164
Alignment:
| Q |
26 |
tgcagacaattgagcaacaacgaaatattttgacaatgctagagaaatctttggcaaaagaaagggatcttgagaataattt |
107 |
Q |
| |
|
|||| |||| ||||||||| |||| ||||||| ||||| ||||||||||||||||| |||| ||||| ||||| ||||| |
|
|
| T |
5662083 |
tgcaaacaactgagcaacatagaaacattttgaggatgcttgagaaatctttggcaaatgaaatagatctcgagaagaattt |
5662164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University