View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15781_high_6 (Length: 281)
Name: NF15781_high_6
Description: NF15781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15781_high_6 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 3573394 - 3573113
Alignment:
| Q |
1 |
caatcacaagtaacttggaattttggaagaatcaactgcacaatactttggcatttcactaggtctgctacactgttgataatatgcatgatcatcattc |
100 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3573394 |
caatcacaagtgacttagaattttggaagaatcaactgcacaatactttggcatttcattaggtctgctacagtgttgataatatgcatgatcatcattc |
3573295 |
T |
 |
| Q |
101 |
acataatcacattcatttcactctcttaaaaagtacaaacatgaaagaattaa-aaaatctaaatgcaccatatgtttctcaaaacatatgaattctcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3573294 |
acataatcacattcatttcactctcttaaaaagtacaaacttgaaagaattaaaaaaatctaaatgcaccatatgtttctcaaagcatatgaattctcat |
3573195 |
T |
 |
| Q |
200 |
tgtttgcttcagaaatcacttctcattggtatggtgtagttttggctcactttccaggggcaaagtttgtggcataggccca |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3573194 |
tgtttgcttcagaaatcacttctcattggtatggtgtagttttggctcactttccaggggcaaagtttgtggcataggccca |
3573113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 281
Target Start/End: Complemental strand, 3570116 - 3570066
Alignment:
| Q |
231 |
tggtgtagttttggctcactttccaggggcaaagtttgtggcataggccca |
281 |
Q |
| |
|
|||||||||| | ||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
3570116 |
tggtgtagttattgcttattttccaggggcaaagtttgtggcataggccca |
3570066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 281
Target Start/End: Complemental strand, 3576441 - 3576397
Alignment:
| Q |
237 |
agttttggctcactttccaggggcaaagtttgtggcataggccca |
281 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
3576441 |
agtttttgctcactttccggggacaaagtttgtggcaaaggccca |
3576397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University