View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15781_low_4 (Length: 444)
Name: NF15781_low_4
Description: NF15781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15781_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 108 - 431
Target Start/End: Original strand, 4367339 - 4367662
Alignment:
| Q |
108 |
tttaatcgtggtggtcatagcattgataaggctaatgctggtgaagaagatagcaatggctttgttattcctgaaacggttcattttttgattccatgct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4367339 |
tttaatcgtggtggtcatagcattgataaggctaatgctggtgaagaagatagcaatggctttgttattcctgaaaaggttcattttttgattccatgca |
4367438 |
T |
|
| Q |
208 |
agtgtttatcttttagttttaagtgcatgtgtaaattgtgttnnnnnnngtgcatgtgtaaattgttgtttgaattggtgttatggtttaagctttttca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4367439 |
agtgtttatcttttagttttaagtgcatgtgtaaattgtgttaaaaaaagtgcatgtgtaaattgttgtttgaattggtgttatggtttaagctttttca |
4367538 |
T |
|
| Q |
308 |
tgttttggtagcttgatggggggaaattgcacgcagttcatttttgttggtaatgtgggtttatttctatgattgtgatttgtttgttacttgtgaactt |
407 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4367539 |
tgttttggtggcttgatggggggaaattgcacgcagttcatttttgttggtaatgtgggtttatttctatgattgtgatttgtttgttacttgtgaactt |
4367638 |
T |
|
| Q |
408 |
ttttactgtgaatgtgagtgtgat |
431 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4367639 |
ttttactgtgaatgtgagtgtgat |
4367662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University