View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15781_low_8 (Length: 289)

Name: NF15781_low_8
Description: NF15781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15781_low_8
NF15781_low_8
[»] chr3 (1 HSPs)
chr3 (56-122)||(8140198-8140264)


Alignment Details
Target: chr3 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 56 - 122
Target Start/End: Original strand, 8140198 - 8140264
Alignment:
56 agatttattaaataactaacgtatcaggattatattatagactaaacatatcatttatttaacgaat 122  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||    
8140198 agatttattaaataactaacgtatcaggattatattatagtctaaacatatcatttatttaatgaat 8140264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University