View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15783_high_11 (Length: 231)
Name: NF15783_high_11
Description: NF15783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15783_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 30 - 214
Target Start/End: Complemental strand, 33494220 - 33494036
Alignment:
| Q |
30 |
aatagacactaacattaaataacatcagcnnnnnnnttaatagagtcggaagatttaagtaagtaatcccaaaatggatttggatcatcttcttcactat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
33494220 |
aatagacactaacattaaataacatcagcagaaaaattaatagagtcggaagatttgagtaagtaattcgaaaatggatttggatcatcttcttcactat |
33494121 |
T |
 |
| Q |
130 |
ttcttacaaatgctacattttgctatgcattgttatgttagctgccccacttcttgacaaattcatcccttcatccacctaaaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33494120 |
ttcttacaaatgctacattttgctatgcatttttatgttagctgccccacttcttgacaaattcatcccttcatccacctaaaag |
33494036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University