View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15783_low_13 (Length: 214)
Name: NF15783_low_13
Description: NF15783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15783_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 7729918 - 7729740
Alignment:
| Q |
16 |
atgaaaggctttctgaagtcaaagagagctagtaccggtgcaaacgtgatagctagcttgagagcttgtaaggcttcagttgtagagggactccatacga |
115 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7729918 |
atgaaaggctttgtgaagtcagagagagctagtaccagtgcagacgtgatagctagcttgagagcttgtaaggcttcagttgtagaggaactccatacga |
7729819 |
T |
 |
| Q |
116 |
atgcttccttcttcaagattttagttaatggagtggtaattgtggaataatggcacacaaatcttctatagtaaccgga |
194 |
Q |
| |
|
| |||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7729818 |
acgcttccttcttcaagagtttagttaatggagcggtaattgtagaataatggcacacaaatcttctatagtaaccgga |
7729740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University