View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15784_high_8 (Length: 242)
Name: NF15784_high_8
Description: NF15784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15784_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 3713265 - 3713465
Alignment:
| Q |
1 |
ttgtatgaatgtctaggttcagttatatgtaatgttagaatagaaggtgcattaaatgtaggttttgtatgggatagaaggggatctttaagagaacatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713265 |
ttgtatgaatgtctaggttcagttatatgtaatgttagaatagaaggtgcattaaatgtaggttttgtatgggatagaaggggatctttaagagaacatg |
3713364 |
T |
 |
| Q |
101 |
caggtgtttggaaagatgaaccttgaaacgaagctgaagatatcaagggtccacatttgtctccccaacccgtattttcagatcatttttaaacactagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713365 |
caggtgtttggaaagatgaaccttgaaacgaagctgaagatatcaagggtccacatttgtctccccaacccgtattttcagatcatttttaaacactagg |
3713464 |
T |
 |
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
3713465 |
g |
3713465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University