View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15784_low_8 (Length: 279)
Name: NF15784_low_8
Description: NF15784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15784_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 25 - 271
Target Start/End: Original strand, 9516575 - 9516821
Alignment:
| Q |
25 |
aaggaggtggaggtctgttccgtttaatcatccatcgacatttgaaacgatgttaatggaaactgatttgaagaacagaatcaaaaacgatctcgaatcg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9516575 |
aaggaggtggaggtctgttccgtttaatcatccatcgacatttgaaacgatgttaatggaaactgatttgaagaacagaataaaaaacgatctcgaatcg |
9516674 |
T |
|
| Q |
125 |
tttttgaaagcgaagaattattatcggagactcggtcgtgtttggaaacggagcttcttgttatacggtgaatccggtaccggaaaatctagctttgttg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9516675 |
tttttgaaagcgaagaattattatcggagactcggtcgtgtttggaaacggagcttcttgttatacggtgaatccggtaccggaaaatctagctttgttg |
9516774 |
T |
|
| Q |
225 |
cagccatggcgaattttctttgctatgatgtatatgatgttcatctc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9516775 |
cagccatggcgaattttctttgctatgatgtatatgatgttgatctc |
9516821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 243
Target Start/End: Complemental strand, 48947379 - 48947303
Alignment:
| Q |
167 |
tggaaacggagcttcttgttatacggtgaatccggtaccggaaaatctagctttgttgcagccatggcgaattttct |
243 |
Q |
| |
|
||||||||||||||| | ||||||||| ||||| |||||||||||||| ||| | || |||||||| |||||||| |
|
|
| T |
48947379 |
tggaaacggagcttccttttatacggttcttccggcaccggaaaatctagttttatcgccgccatggccaattttct |
48947303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University