View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15784_low_9 (Length: 254)
Name: NF15784_low_9
Description: NF15784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15784_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 3646093 - 3645859
Alignment:
| Q |
1 |
atggtatatgtgcttgttctattgtgctagcacttgttgtgtttttgtttggaacctgtaagtatcggtacaagaaaccggtaggtagtcccttgactca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3646093 |
atggtatatgtgcttgttctattgtgctagcacttgttgtgtttttgtttggaacctgtaagtatcggtacaagaaaccggtaggtagtcccttgactca |
3645994 |
T |
|
| Q |
101 |
gattgtggtggtgtttgtggccgcttggaggaagaggcacttgcaattgccttctgagtccgcattgctctttaacgacgatgccatcttacatgaacca |
200 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645993 |
gattgcggtagtgtttgtggccgcttggaggaagaggcacttgcaattgccttctgattccgcattgctctttaacgacgatgccatcttacatgaacca |
3645894 |
T |
|
| Q |
201 |
ccaaggatcaagaagcagaggttaccgcacagcaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645893 |
ccaaggatcaagaagcagaggttaccgcacagcaa |
3645859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 84 - 171
Target Start/End: Complemental strand, 3658443 - 3658356
Alignment:
| Q |
84 |
ggtagtcccttgactcagattgtggtggtgtttgtggccgcttggaggaagaggcacttgcaattgccttctgagtccgcattgctct |
171 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||||||||||| |||||||||||||| ||| |||||||||| ||||| || ||||||||| |
|
|
| T |
3658443 |
ggtagtcctttgactcagattgcggtcgtgtttgtggctgcttggaggaagagacacatgcaattgccctctgattcttcattgctct |
3658356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 84 - 137
Target Start/End: Original strand, 41873045 - 41873098
Alignment:
| Q |
84 |
ggtagtcccttgactcagattgtggtggtgtttgtggccgcttggaggaagagg |
137 |
Q |
| |
|
|||||||| ||||||||||||| ||||| | |||||| ||||||||||||||| |
|
|
| T |
41873045 |
ggtagtcctttgactcagattgcagtggtttatgtggctgcttggaggaagagg |
41873098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University