View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15785_high_4 (Length: 434)
Name: NF15785_high_4
Description: NF15785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15785_high_4 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 20 - 424
Target Start/End: Complemental strand, 47193719 - 47193314
Alignment:
| Q |
20 |
agtcgaggagttcttcctataacataaattcaaagaaaataaagatgttgttcaccgaaagataggcaatttattgacttcaagagcggaaaggaatact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47193719 |
agtcgaggagttcttcctataacataaattcaaagaaaataaagatgttgttcaccgaaagataggcaatttattgacttcaagagcggaaaggaatact |
47193620 |
T |
|
| Q |
120 |
tacctatgcctcgagtcccagtctcctagtggtggggatggtaaagggaaatgtctggttctggctatgagatgtctttaccaagcctttcctccctggc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47193619 |
tacctatgcctcgagtcccagtctcctagtggtggggatggtaaaggaaaatgtctggttctggctatgagatgtctttgccaagcctttcctccctggc |
47193520 |
T |
|
| Q |
220 |
ggtctacaccaggtatgaactcaatttaaactgggatcagagg-nnnnnnnggctcttttcctttctaccatgctttaggctgcttataggaaaaaagac |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47193519 |
ggtctacaccaggtatgaactcaatttaaactgggatcagaggaaaaaaaaggctcttttcctttctaccatgctttaggctgcttataggaaaaaagac |
47193420 |
T |
|
| Q |
319 |
tctagttccttgctcatttacgttgtaggcatagagctatgggaatgctcaaaggatgagcagcgaccggcctacgttttgactagtcatcatcggttta |
418 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47193419 |
tctagttccttgctcatttacgctgtaggcgtagagctatgggaatgctcaaaggatgagcaccgaccggcctacgttttgactagtcatcatcggttta |
47193320 |
T |
|
| Q |
419 |
tctgtg |
424 |
Q |
| |
|
|||||| |
|
|
| T |
47193319 |
tctgtg |
47193314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 418
Target Start/End: Complemental strand, 4748 - 4702
Alignment:
| Q |
372 |
ggatgagcagcgaccggcctacgttttgactagtcatcatcggttta |
418 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4748 |
ggatgagcgacgatcggcctacgttttgactagtcatcatcggttta |
4702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University