View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15786_high_5 (Length: 398)
Name: NF15786_high_5
Description: NF15786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15786_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 31 - 186
Target Start/End: Original strand, 2661020 - 2661175
Alignment:
| Q |
31 |
ataggcctggtttagggttaggttttgggtcggctagtgtatcggggtctggtctaggatttaattctggtcgtggtgtgaatggttcagataggaatga |
130 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661020 |
ataggcctggttttgggttaggttttgggtcggctagtgtatcggggtctggtctaggatttaattctggtcgtggtgtgaatggttcagataggaatga |
2661119 |
T |
 |
| Q |
131 |
tgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661120 |
tgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg |
2661175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 261 - 398
Target Start/End: Original strand, 2661253 - 2661390
Alignment:
| Q |
261 |
ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttata |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661253 |
ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacaaagggaattggaatgaagctgcttgagaagatgggttata |
2661352 |
T |
 |
| Q |
361 |
aagggggtggtcttgggaagaatgagcagggtatttta |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661353 |
aagggggtggtcttgggaagaatgagcagggtatttta |
2661390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 269 - 394
Target Start/End: Original strand, 25951995 - 25952117
Alignment:
| Q |
269 |
gggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggt |
368 |
Q |
| |
|
|||| ||||||||||||| || || ||||||||||||||| ||||| ||| | ||||| |||||||||||| | ||||| |||||||||||||| ||| |
|
|
| T |
25951995 |
gggtctaggtcaggagggatcagttgatgttgggaaattcaagagttata---acggaatgggaatgaagctgatggagaaaatgggttataaaggaggt |
25952091 |
T |
 |
| Q |
369 |
ggtcttgggaagaatgagcagggtat |
394 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25952092 |
ggtcttgggaagaatgagcagggtat |
25952117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 274 - 394
Target Start/End: Original strand, 25945404 - 25945521
Alignment:
| Q |
274 |
taggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggtggtct |
373 |
Q |
| |
|
||||||| |||| || ||||||||||||||||| |||| | ||| || ||||| |||||||||||| | ||||| |||||||||||||| |||||||| |
|
|
| T |
25945404 |
taggtcacgaggaatcagtggatgttgggaaattggagaat--tac-aacggaatgggaatgaagctgatggagaaaatgggttataaaggaggtggtct |
25945500 |
T |
 |
| Q |
374 |
tgggaagaatgagcagggtat |
394 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25945501 |
tgggaagaatgagcagggtat |
25945521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University