View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15787_low_5 (Length: 387)
Name: NF15787_low_5
Description: NF15787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15787_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 1 - 369
Target Start/End: Complemental strand, 35022132 - 35021764
Alignment:
| Q |
1 |
cggagaggaattggagaagtggaccgatcaggttaacgccgggaatttcttgaaacgaggcggaggaaggtggaaaaggggaagttacggcggtgacgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35022132 |
cggagaggaattggagaagtggaccgatcaggttaacgccgggaatttcttgaaacgcggcggaggaaggtggaaaaggggaagttacggcggtgacgaa |
35022033 |
T |
 |
| Q |
101 |
ggagaaggaagttgaaacggagattttacgaatgccgaggtcgcgaagggagatgtgaacgttggagatggcgggaaggaggttgttgatggattcaggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35022032 |
ggagaaggaagttgaaacggagattttacgaataccgaggtcgcgaagggagatgtgaacgttggagatggcgggaaggaggttgttgatggattcaggg |
35021933 |
T |
 |
| Q |
201 |
taaacgtcggtgaaggcgttaccgacggagatggtggtgattttggcgcgtgggtagaagggaagcacgtgagtgtagatccatgcacgtgcgatggagc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021932 |
taaacgtcggtgaaggcgttaccgacggagatggtggtgattttggcgcgtgggtagaagggaagcacgtgagtgtagatccatgcacgtgcgatggagc |
35021833 |
T |
 |
| Q |
301 |
ggttagtagcgatgtgagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaa |
369 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021832 |
ggttagtggcgatgggagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaa |
35021764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 121 - 209
Target Start/End: Original strand, 42811487 - 42811575
Alignment:
| Q |
121 |
agattttacgaatgccgaggtcgcgaagggagatgtgaacgttggagatggcgggaaggaggttgttgatggattcagggtaaacgtcg |
209 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42811487 |
agattttatggatgccgaggtcgtgaagggagatgtgaacgttggagatggcggggaggaggttgttgatggattcagggtaaacgtcg |
42811575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University