View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15788_high_26 (Length: 307)
Name: NF15788_high_26
Description: NF15788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15788_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 861891 - 861591
Alignment:
| Q |
1 |
aaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatattgctgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
861891 |
aaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatattgctgac |
861792 |
T |
 |
| Q |
101 |
tctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctacatttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
861791 |
tctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctacatttct |
861692 |
T |
 |
| Q |
201 |
gctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccctatgctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
861691 |
gctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccctctgctt |
861592 |
T |
 |
| Q |
301 |
c |
301 |
Q |
| |
|
| |
|
|
| T |
861591 |
c |
861591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 1223168 - 1222868
Alignment:
| Q |
1 |
aaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatattgctgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223168 |
aaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatattgctgac |
1223069 |
T |
 |
| Q |
101 |
tctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctacatttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223068 |
tctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctacatttct |
1222969 |
T |
 |
| Q |
201 |
gctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccctatgctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1222968 |
gctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccctctgctt |
1222869 |
T |
 |
| Q |
301 |
c |
301 |
Q |
| |
|
| |
|
|
| T |
1222868 |
c |
1222868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University