View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_high_36 (Length: 327)
Name: NF15789_high_36
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 134 - 311
Target Start/End: Original strand, 15381183 - 15381363
Alignment:
| Q |
134 |
ggtttttggagcctttttcctgtgtgatgtgtattgaattcattaatagcaattataaattttatgatatatatc---ttttcacatatctcctttactt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | | ||||||||||||| |||||||| |
|
|
| T |
15381183 |
ggtttttggagcctttttcctgtgtgatgtgtattgaattcattaatagcaattataaattttattatatcttttcagttttcacatatctactttactt |
15381282 |
T |
 |
| Q |
231 |
tcattcattttatatatcagcttcttaattgacccttgaatgaattctgctcttgatgaaatctatgcatgaatcttataa |
311 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15381283 |
tctttcattctatatatcagcttcttaattgacccttgaatgaattctgctcatgatgaaatctatgcatgaatcttataa |
15381363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 15381034 - 15381086
Alignment:
| Q |
1 |
acaggacccattatctggtgtccaacgtgtgtgatggaaacacgtatctatag |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15381034 |
acaggacccattatctggtgtccaacgtgtgtggtggaaacacgtatctatag |
15381086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University