View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_high_40 (Length: 287)
Name: NF15789_high_40
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 1831740 - 1831558
Alignment:
| Q |
1 |
acaattgtattcagaatctacagacacagtggcatatatgtaattaggcgtaaacgtacctccatggcacaatcaatgtcttcttcagtggcagttgccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1831740 |
acaattgtattcagaatctacagacacagtggcatatatgtaattaggcgtaaacgtacctccatggcacaatcaatgtcttcttcagtggcagttgccc |
1831641 |
T |
 |
| Q |
101 |
aaagtggatgatttctaattgcaacttccatcgacagaaagaagtcttgaactctttgaccatcattttcaggttttggttgg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1831640 |
aaagtggatgatttctaattgcaacttccatcgacagaaagaagtcttgaactcttcgaccatcattttcaggttttggttgg |
1831558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University