View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15789_high_40 (Length: 287)

Name: NF15789_high_40
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15789_high_40
NF15789_high_40
[»] chr3 (1 HSPs)
chr3 (1-183)||(1831558-1831740)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 1831740 - 1831558
Alignment:
1 acaattgtattcagaatctacagacacagtggcatatatgtaattaggcgtaaacgtacctccatggcacaatcaatgtcttcttcagtggcagttgccc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1831740 acaattgtattcagaatctacagacacagtggcatatatgtaattaggcgtaaacgtacctccatggcacaatcaatgtcttcttcagtggcagttgccc 1831641  T
101 aaagtggatgatttctaattgcaacttccatcgacagaaagaagtcttgaactctttgaccatcattttcaggttttggttgg 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
1831640 aaagtggatgatttctaattgcaacttccatcgacagaaagaagtcttgaactcttcgaccatcattttcaggttttggttgg 1831558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University