View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_high_44 (Length: 272)
Name: NF15789_high_44
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_high_44 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 33 - 272
Target Start/End: Original strand, 15380735 - 15380975
Alignment:
| Q |
33 |
cacagagcagttatatcaattgggttgaaactttggaatctgaactatttcttataatgggtttttcttagtcaatctcctcattttggacagtatgctt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380735 |
cacagagcagttatatcaattgggttgaaactttggaatttgaactatttcttataatgggtttttcttagtcaatctcctcattttggacagtatgctt |
15380834 |
T |
 |
| Q |
133 |
tcttctttcaacttgcacaagtcactttgatgggatcccacagtt-nnnnnnntgttactagtagtaagttgaagctagctgcattgtgtggacttttgg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380835 |
tcttctttcaacttgcacaagtcactttgatgggatcccacagttaaaaaaaatgttactggtagtaagttgaagctagctgcattgtgtggacttttgg |
15380934 |
T |
 |
| Q |
232 |
agtgtgcaatgcacgtgagtatgtgtgatttttgttctgtt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380935 |
agtgtgcaatgcacgtgagtatgtgtgatttttgttctgtt |
15380975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University