View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_high_51 (Length: 242)
Name: NF15789_high_51
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_high_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 24 - 232
Target Start/End: Complemental strand, 4641554 - 4641346
Alignment:
| Q |
24 |
tgtctccctccccaacaaaccaagaagtttccttctagtttaaacatgtctatgccgatccacaacctctaatacttaccaagcaacaactttcagcttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
4641554 |
tgtctccctccccaacaaaccaagaagtttccttctagtttaaacatgtctatgccgatccacaacctctgatacttaccaagcaacaactttcagattt |
4641455 |
T |
 |
| Q |
124 |
catttaattaatcacaaattcatagaaatcaaatattaaaaataacacaaggacaagtggttgtggatgccgggtgaggatggtttgttttcggtaaaat |
223 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4641454 |
catttaattaatcacaaatccatagaaatcaaatattaaaaataacacaaggacaagtggttgtggatgccgggtgaggatggtttgttttcggtaaaat |
4641355 |
T |
 |
| Q |
224 |
ccgcctatg |
232 |
Q |
| |
|
||||||||| |
|
|
| T |
4641354 |
ccgcctatg |
4641346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University