View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_high_54 (Length: 239)
Name: NF15789_high_54
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_high_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 11 - 169
Target Start/End: Original strand, 50644687 - 50644845
Alignment:
| Q |
11 |
tatgaaggtaacacatgtannnnnnnnactctcttcctaaacaaaactcaataccttagtaaaaccttgcagaggaaagacagggagaaggttcgttact |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50644687 |
tatgaaggtaacacatgtatttttttcactctcttcctaaacaaaacccaataccttagtaaaaccttgcagaggaaagacagggagaaggttcgttact |
50644786 |
T |
 |
| Q |
111 |
gtgagtgtagagttatgcatttaaaatcaagcggttattgaaaagagctttcgaaattt |
169 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50644787 |
gtgaatgtagagttatgcatttaaaatcaagcggttattgaaaagagctttcgagattt |
50644845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University