View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_high_55 (Length: 236)
Name: NF15789_high_55
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_high_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 45399831 - 45399626
Alignment:
| Q |
15 |
taatctacacataaatccatcaactcgtaaaccaaaagaaggatctaaagaaaattgaattggttaacctcacaccaattgcaagagcacgaaaattaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45399831 |
taatctacacataaatccatcaactcgtaaaccaaaagaaggatctaaagaaaattgaattggttaacctcacaccaattgcaagagcacgaaaattaaa |
45399732 |
T |
 |
| Q |
115 |
ggcacaagaaatcaagggcagtccaacccagaaattaaacacaacagtggttcaaccctcttttcataaaacccatgaactttaacccataaaaaggagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45399731 |
ggcacaagaaatcaagggcagtccaacccagaaattaaacacaatagtggtttaaccctcttttcataaaacccatgaactttaacccataaaaaggagt |
45399632 |
T |
 |
| Q |
215 |
ggctta |
220 |
Q |
| |
|
|||||| |
|
|
| T |
45399631 |
ggctta |
45399626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University