View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_high_62 (Length: 225)
Name: NF15789_high_62
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_high_62 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 57 - 208
Target Start/End: Complemental strand, 31651683 - 31651532
Alignment:
| Q |
57 |
agaactagaactagaatacaagaaaataattttagggatgnnnnnnnnnnnnnnnnnngcaccaaccaaaccannnnnnnagcaaggaaaaatcatgcat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31651683 |
agaactagaactagaatacaagaaaataattttagggatgaaaaattaaaattaaaaagcaccaaccaaaccatttttttagcaaggaaaaatcatgcat |
31651584 |
T |
 |
| Q |
157 |
tgtgttatttcttccaccaaaatgattgtgaagtagagagtgatgctctcct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31651583 |
tgtgttatttcttccaccaaaatgattgtgaagtagagagtgatgctctcct |
31651532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University