View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_high_67 (Length: 210)
Name: NF15789_high_67
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_high_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 4 - 190
Target Start/End: Original strand, 36904034 - 36904220
Alignment:
| Q |
4 |
aattacccctgcagcaattgtctaagtgttctctcttctctggagcaaattccacaatgaggatttgccggtgtnnnnnnnnnnnnnnnctcaaacgcca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36904034 |
aattacccctgcagcaattgtctaagtgttctctcttctctggagcaaattccacaatgaggatttgccggtgttctctcttctctctcctcaaacgcca |
36904133 |
T |
 |
| Q |
104 |
tttttcggcgacccaaccacttccgacgtaactccggtgtgctttcccctttcatttttcacacttttctcttcgattttcacgatc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36904134 |
tttttcggcgacccaaccacttccgacgtaactccggtgtgctttcccctttcatttttcacacttttctcttcgattttcacgatc |
36904220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 93 - 185
Target Start/End: Complemental strand, 28105950 - 28105858
Alignment:
| Q |
93 |
ctcaaacgccatttttcggcgacccaaccacttccgacgtaactccggtgtgctttcccctttcatttttcacacttttctcttcgattttca |
185 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||| ||||||||||||||| ||||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
28105950 |
ctcaaacgccattttccggcgacccaaccacgtccggcgtaactccggtgtgatttccccctttatttttcacacttttctcttcgtttttca |
28105858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University