View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_low_45 (Length: 298)
Name: NF15789_low_45
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 53 - 289
Target Start/End: Original strand, 2376672 - 2376908
Alignment:
| Q |
53 |
ttggcatttcacaaacaccgcaagattaatttgtctggtgattgcaccaatcacaaatctattaactatctcttgaagacctgtgacctcgaagaggtca |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2376672 |
ttggcatttcacaaacaccgcaagattaatttgtctggtgattgcaccaatcacaaatctattaactatctcttgaagaactgtgacctcgaagaggtca |
2376771 |
T |
 |
| Q |
153 |
tcatgacagagttgatacaatgcaagagatggaccctgcacgaagacgatgatggatattgatagttggaattttatagatttatagtttcatcaaatta |
252 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2376772 |
tcatgacagagttgatatcatgcaagagatggaccctgcatgaagacgatgatggatattgatatttggaattttatagatttatagtttcatcaaatta |
2376871 |
T |
 |
| Q |
253 |
atgtacctacaactgtaaacatcagtcattttcatct |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2376872 |
atgtacctacaactgtaaacatcagtcattttcatct |
2376908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 2376618 - 2376657
Alignment:
| Q |
16 |
actactaagtcttgttttgtgctacatgaagatgatattg |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2376618 |
actactaagtcttgttttgtgctacatgaagatgatattg |
2376657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 126
Target Start/End: Original strand, 2373666 - 2373742
Alignment:
| Q |
53 |
ttggcatttcacaaacaccgcaagattaatttgtctggtgattgcacca---atcacaaatctattaactatctctt |
126 |
Q |
| |
|
|||||| ||| ||||| ||||||||||||||| || ||| |||||| || ||||| ||||||||||||||||||| |
|
|
| T |
2373666 |
ttggcacttcccaaactccgcaagattaatttatcaggtaattgcatcaaagatcaccaatctattaactatctctt |
2373742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University