View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_low_52 (Length: 276)
Name: NF15789_low_52
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 388639 - 388892
Alignment:
| Q |
1 |
ttgatggtgattatgataatgatgagtttttgttgtgtctggaacaccgcatcttggtgtgatcatttgagaaactgtgttcgaatcgagtttaccggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
388639 |
ttgatggtgattatgataatgatgagtttttgttgtgtctggaacaccgcatcttggtgtgatcatttgagaaactgtattcgaatcgagtttaccggtt |
388738 |
T |
 |
| Q |
101 |
acttggagtccaagatttctttggtatttgatgatagctgattcaaaattcgaatcaaatttgtcgctgaatgtgtcattgtttttaatgtacccgaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388739 |
acttggagtccaagatttctttggtatttgatgatagctgattcaaaattcgaatcaaatttgtcgctgaatgtgtcattgtttttaatgtacccgaaac |
388838 |
T |
 |
| Q |
201 |
gagataggtatcttttgaactgtgatattcctgtgatgttgttgcctctgacag |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388839 |
gagataggtatcttttgaactgtgatattcctgtgatgttgttgcctctgacag |
388892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University